DNA Sequence Analyzer
Runhang Shu / 2025-06-23
DNA Sequence Analysis Tool
This interactive tool helps you analyze DNA sequences with various functions including flanking sequence extraction, reverse complement calculation, and GC content analysis.
Input Sequence
How to Use
1. Flanking Sequences
- Without target: Enter a sequence and flanking length. Gets flanking regions from both ends.
- With target: Enter a target sequence to find within your input sequence, then extract flanking regions around each occurrence.
2. Reverse Complement
- Calculates the reverse complement of your DNA sequence.
- Useful for primer design and analyzing both strands.
3. GC Content
- Calculates the percentage of G and C bases in your sequence.
- Important for PCR optimization and melting temperature estimation.
Features
- ✅ Input validation (only accepts valid DNA bases: A, T, G, C, N)
- ✅ Multiple analysis modes
- ✅ Handles both simple and complex sequence analysis
- ✅ Color-coded results for easy visualization
- ✅ Responsive design for mobile devices
Example Sequences
Test sequence: ATCGATCGATCGAAGCTTCGATCGATCGATCG
- Try with flanking length: 10
- Try with target sequence:
AAGCTT(EcoRI recognition site)
